Klebsiella Pneumoniae Isolated From Intensive Care Unit Patients with Respiratory Tract Infections: Characterization by Pulsed-Field Gel Electrophoresis, Antimicrobial Resistance and Pcrs for Carbapenemase Genes Detection

Klebsiella pneumoniae is the most common causes of pneumonia, urinary tract and bloodstream infections in patients in intensive care unit (ICU). In this study, twenty-two K. pneumoniae cultures were isolated from patients with respiratory tract infections in the same intensive care unit during 2010. All isolates were characterized by XbaI-pulsed-field gel electrophoresis, and the Minimum Inhibitory Concentration for fourteen antibiotics, including carbapenems was evaluated to define the resistance profile. PCRs were developed to detect genes coding for carbapenemases of class A (KPC, GES), B (VIM, IMP, NDM-1) and D (OXA-48), and plasmid-mediated AmpC betalactamases. K. pneumoniae isolates showed a multidrug-resistance profile: 73% was intermediate and 18% classified as resistant to imipenem, while 9% was resistant to meropenem. Ninety five percent of isolates was resistant to ceftazidime, ciprofloxacin and levofloxacin, the 14% and 5% observed as intermediate and resistant to amikacin. All cultures were resistant to the remaining antibiotics. Eight resistotypes were recognized, while PFGE identified 15 pulsotypes indicating heterogeneity of strains circulation in the hospital ward during the study period. Bla KPC, considered as the most important carbapenems resistance-related gene was not detected in any culture, but 90.9% harbored bla VIM, suggesting the production of VIM carbapenemase as the only mechanism for strains intermediate or resistant to carbapenems. The carbapenemases GES, IMP, NDM-1, OXA48 and AmpC beta-lactamases were not detected in any culture, which is in agreement with the sporadic reports from elsewhere in Italy. This study provides hitherto invaluable information for the implementation of surveillance of K. pneumoniae infections in nosocomial settings. Giancarlo Ripabelli1*, Michela Lucia Sammarco1, Romeo Flocco2, Massimiliano Scutellà3, Laura Recchia1, Guido Maria Grasso1 and Manuela Tamburro1 1Department of Medicine and Health Sciences, University of Molise, Italy 2Department of Anesthesia and Resuscitation Unit “A. Cardarelli” Hospital, Azienda Sanitaria Regionale Molise, Italy 3Department of Laboratory Medicine Unit “A. Cardarelli” Hospital, Azienda Sanitaria Regionale Molise, Italy Giancarlo Ripabelli, et al. Journal of Respiratory Medicine and Lung Disease Remedy Publications LLC. 2017 | Volume 2 | Issue 1 | Article 1008 2 stays and surgery before admission in the intensive care unit; urinary and central venous catheterization; mechanic ventilation; tracheotomy; underlying diseases and immunosuppression; and transfer from settings where carbapenem resistance is endemic [13]. Despite global attempts to control the spread of carbapenemresistance, population-weighted mean throughout the EU/EEA has shown an increasing trend of carbapenemase producing K. pneumoniae from 6% in 2011 to 7.3 % in 2014 [14]. Countries reporting the highest rates of carbapenem resistance also showed combined resistance to fluoroquinolones, third-generation cephalosporins and aminoglycosides [15]. In Italy, carbapenem resistant K. pneumoniae are highly endemic, and healthcare-associated outbreaks have been described [16], with a mean prevalence of 34.3% in 2013 [10]. Multiple mechanisms are involved in the carbapenems resistance, including the production of various types of carbapenemases (KPC, NDM, VIM, OXA-48-like), which are the most mechanism in Europe [9,17]. However there are alternative resistance mechanisms including reduced permeability of outer membrane mediated by the loss of porins, and the up-regulation of efflux systems, and these often occur with the over-expression of genes coding for AmpC betalactamases [13] or extended-spectrum beta-lactamases [18]. Based on the experiences from national and international surveillance networks, in April 2014, the World Health Organization (WHO) published the first global report on surveillance of antimicrobial resistance. This report concluded that surveillance data, if available, are essential for treatment choices, understanding trends, identifying priority areas for interventions, and monitoring the impact of interventions to limit resistance [19]. Hence, the implementation of the epidemiological and laboratory surveillance are essential to reduce the spread of multiresistance. In this context, molecular characterization of K. pneumoniae is crucial both for the identification of strains responsible for outbreaks, to inform therapeutic options and to implement epidemiological surveillance [20]. Since no previous investigations were conducted in the Molise Region, Central Italy, the aim of the present study was to characterize K. pneumoniae cultures isolated from hospitalized patients with respiratory tract infections in an intensive care unit. Materials and Methods Selection of K. pneumoniae cultures Molise is the second smallest region of Italy (4,438 sq km), located in a central-east position with the city of Campobasso as the regional capital. The regional healthcare system is managed by the regional health authority, known as the Azienda Sanitaria Regionale del Molise (A.S.Re.M), and the study was conducted in the “Antonio Cardarelli” Hospital in Campobasso, which contains 336 beds, of which 287 for acute care and 49 for day-hospital/surgery. During 2010, in monitoring K. pneumoniae infections, the hospital reported isolates which were either sensitive or resistant to carbapenems. Between May and November 2010 a total of twenty-two cultures of K. pneumoniae were selected (Table 1): all cultures were previously isolated and identified from the same hospital intensive care unit (ICU), consisting of 6 beds. The bacterial cultures were recovered from patients with respiratory tract infections, and the mean age was 64±16.38 years (median 71 years, interquartile range 21-87 years). Seventeen patients (77%) were male. The clinical specimens from respiratory secretions were subcultured on purified on McConkey (Biolife, Milan, Italy) agar, and plates were incubated at 37°C overnight. Pure cultures were stored at 4°C until the use for further DNA isolation and amplification. Antimicrobial susceptibility testing K. pneumoniae isolates were tested for antibiotic susceptibility using the Phoenix Automated Microbiology System (Becton Dickinson Diagnostic Systems, Sparks, United States) in collaboration with the hospital microbiology laboratory. The Minimal inhibitory concentrations (MICs) determinations were performed for different classes of antibiotics, testing imipenem and meropenem (carbapenems); ampicillin, amoxicillin-clavulanate, piperacillin and piperacillin-tazobactam (penicillins); ceftazidime, cefepime and cefotaxime (cephalosporins); amikacin and gentamicin (aminoglycosides); ciprofloxacin and levofloxacin (fluoroquinolones), and aztreonam (monobactams). Results were interpreted according to the breakpoints values recommended by the European Committee on Antimicrobial Susceptibility Testing [21], classifying the strains in three susceptibility categories as “sensitive”, when the strain is inhibited by a concentration of an antibacterial agent associated with a high likelihood of therapeutic success; “intermediate” inhibited by a concentration of an antibacterial agent associated with an uncertain therapeutic effect, and “resistant” inhibited by a concentration of an antibacterial agent associated with a high likelihood of therapeutic failure. Molecular Epidemiology Study Pulsed-field gel elctrophoresis (PFGE) with XbaI enzyme Code of strain Gender Age Date of isolation KP A F 79 26/07/2010 KP B M 77 07/06/2010 KP C M 50 19/07/2010 KP D M 50 23/08/2010 KP E M 69 04/10/2010 KP F M 49 25/10/2010 KP G M 55 24/05/2010 KP H F 77 14/06/2010 KP I F 77 10/05/2010 KP K M 73 26/07/2010 KP L M 80 26/07/2010 KP M M 72 10/05/2010 KP O M 57 22/11/2010 KP P F 74 04/10/2010 KP Q M 51 10/05/2010 KP R F 58 22/11/2010 KP S M 42 02/11/2010 KP T M 73 12/07/2010 KP V M 83 07/06/2010 KP Y M 53 10/05/2010 KP W M 21 02/08/2010 KP Z M 87 29/11/2010 Table 1: Clinical K. pneumoniae strains isolated from bronchial aspirate of intensive care unit patients. Giancarlo Ripabelli, et al. Journal of Respiratory Medicine and Lung Disease Remedy Publications LLC. 2017 | Volume 2 | Issue 1 | Article 1008 3 macrorestriction of genomic DNA was performed to establish clonal relationships between K. pneumoniae isolates, according to the PulsNet protocol. PFGE conditions were as follows: pulse times ranged from 5 to 40s over 24h at 6.0V/cm and at 14°C. The PFGE profiles obtained were converted to TIFF files and subjected to cluster analysis using BioNumerics software package (Applied Maths, Sint-Martens-Latem, Belgium). Patterns interpretation was carried out according to Tenover criteria [22], and following the analysis approach recently described for food borne disease investigations and surveillance [20,23]. Clustering was based on the un weighted pair-group method with arithmetic averages (UPGMA). The Dice correlation coefficient was used to analyze the similarity of banding patterns with 1.0% tolerance and optimization. A 95% cutoff similarity was considered for the interpretation of chromosomal DNA restriction patterns, thus, isolates with <95% similarity profiles were characterized as different PFGE subtypes. In the dendrogram analysis, the assignment of clusters was based on ≥85% similarity level. DNA extraction A bacterial suspension was obtained with pure K. pneumoniae growth into 400 μl Trypton Soy (Biolife) broth medium. Genomic DNA purification was carried out following the protocol of Maxwell® 16 Cell DNA Purification Kit (Promega Corporation, Milan) using the Maxwell® 16 Instrument (Promega). Molecular analysis of resistance-associated genes PCR assays were performed to detect class A carbapenemases (blaKPC and blaGES genes), class B metallo-beta-lactamase (blaIMP, blaVIM and blaNDM-1), class D (blaOXA-48), and AmpC (blaACC, blaLATBIL-CMY, blaMOX-CMY, blaFOX, blaDHA, blaACT-MIR) plasmid-mediated beta-lactamases encoding genes. The presence of target genes was investigated in single PCRs using specific oligonucleotides listed in (Table 2), as previously described [24]. Amplifications were carried out using 2 μl of DNA template in 50 μl of final reaction volume containing 25 μl of PCR Master Mix 1× (Promega, Milan, Italy), and 1.0 μmol l−1 of each primer (Eurogentec, Biosense srl, Milan, Italy). Target genes were amplified using the same conditions of initial denaturation of 95°C for 2 min, followed by 35 cycles at 95°C for 1 min, extension at 72°C for 1 min, and final extension step at 72°C for 5 min. The annealing phase was different depending on the amplified product: blaKPC at 52 °C for 1 min; blaGES and blaACT-MIR at 54 °C for 1 min; blaVIM and blaOXA-48 at 56 °C for 1 min; blaIMP and blaDHA at 45 °C for 1 min; blaNDM-1, blaACC, blaLAT-BIL-CMY at 57 °C for 1 min; blaMOX-CMY at 47°C for 1 min; blaFOX at 53 °C for 1 min. The correct size amplified product was detected by agarose gel electrophoresis (1.0-1.5% m/v concentration, 1X TAE buffer at 100 V for 1 hour). Positive and negative controls and a 100 bp DNA ladder (Promega) were included in each batch of reactions. Results Antibiotic susceptibility patterns among K. pneumoniae isolates The K. pneumoniae isolates showed a multidrug-resistant antibiotype (Table 3). All the strains were resistant to ampicillin, Carbapenemase Target gene Oligonucleotide sequence (5’-3’) Amplicon size Class A KPC (from KPC-1 to KPC-5) Fwd: CATTCAAGGGCTTTCTTGCTGC 538 bp Rev: ACGACGGCATAGTCATTTGC GES (from GES-1 to GES-9, GES-11) Fwd: AGTCGGCTAGACCGGAAAG 399 bp Rev: TTTGTCCGTGCTCAGGAT Class B VIM (VIM-1, 2) Fwd: GATGGTGTTTGGTCGCATA 390 bp Rev: CGAATGCGCAGCACCAG IMP (IMP-9, 16, 18, 22, 25) Fwd: TTGACACTCCATTTACDG 139 bp Rev: GATYGAGAATTAAGCCACYCT NDM-1 Fwd: GGTTTGGCGATCTGGTTTTC 621 bp Rev: CGGAATGGCTCATCACGATC Class D OXA-48-like Fwd: GCTTGATCGCCCTCGATT 281 bp Rev: GATTTGCTCCGTGGCCGAAA AmpC plasmid-mediated β-lactames ACC (ACC-1, 2) Fwd: CACCTCCAGCGACTTGTTAC 346 bp Rev: GTTAGCCAGCATCACGATCC MOX-1, MOX-2, CMY-1, CMY-8-11 and CMY-19 Fwd: GCAACAACGACAATCCATCCT 895 bp Rev: GGGATAGGCGTAACTCTCCCAA LAT-1-3, BIL-1, CMY-2-7, CMY12-18 and CMY21-23 Fwd: CGAAGAGGCAATGACCAGAC 538 bp Rev: ACGGACAGGGTTAGGATAGY DHA (DHA-1, 2) Fwd: TGATGGCACAGCAGGATATTC 997 bp Rev: GCTTTGACTCTTTCGGTATTCG FOX (from FOX-1 to FOX-5) Fwd: CTACAGTGCGGGTGGTTT 162 bp Rev: CTATTTGCGGCCAGGTGA ACT and MIR-1 Fwd: CGGTAAAGCCGATGTTGCG 683 bp Rev: AGCCTAACCCCTGATACA Table 2: List of the target genes, oligonucleotide sequences and PCR products size, as previously described [24]. Giancarlo Ripabelli, et al. Journal of Respiratory Medicine and Lung Disease Remedy Publications LLC. 2017 | Volume 2 | Issue 1 | Article 1008 4 amoxicillin-clavulanate, piperacillin, piperacillin-tazobactam, cefepime, cefotaxime, and aztreonam. Concerning the carbapenems, 73% (n=16) were classified as intermediate for imipenem, and 18% (n=4) as resistant, while the majority (n=20, 91%) of isolates resulted sensitive to meropenem, and only the 9% (n=2) was classified as resistant. The MICs evaluation allowed the identification of 95% (n=21) of cultures as resistant to ceftazidime, while, the 14% (n=3) and 5% (n=1) were intermediate and resistant to amikacin, respectively. The susceptibility patterns were similarly detected for gentamicin, ciprofloxacin and levofloxacin, with the 95% (n=21) of isolates classified as resistant (Table 3). Based on the similarity within the susceptibility patterns, eight different resistotypes were identified among the isolates (Figure 1). Resistotype 1 was shared by 54.5% (n=12) of isolates and characterized by intermediate profile to imipenem, sensitivity to meropenem and amikacin, and resistance to all of the remaining antibiotics. Resistotype 2 (two isolates) showed an intermediate profile to imipenem and amikacin, sensitivity to meropenem, and resistance to all the remaining antibiotics. Resistotype 3 showed intermediate profile to meropenem and amikacin, and resistance to the remaining antibiotics, and were associated with two isolates each. Resistotypes 4 to 8 were associated with one isolate each. Molecular typing by PFGE analysis PFGE analysis resulted in 15 different pulsotypes (PT), assessed at 95% similarity level (Figure 1). PT3 was associated with four isolates, PT13 with three isolates, and PT1 and PT9 with two iso lates each (Figure 1). The molecular typing analysis at 85% similarity cut-off revealed the presence of seven defined clusters, I-VII, grouping nine, one, four, three, three, one and one strain, respectively (Figure 1), Using Simpson’s Index of Diversity [25], the discriminatory power of the phenotypic method based on MICs determination was 0.70 , lower of the 0.95. obtained by PFGE. Prevalence of carbapenems resistance-associated genes The blaKPC and blaGES genes, coding for class A carbapenemases were not detected among the isolate, however, blaVIM gene encoding class B carbapenemase was detected in 90.9% of isolates. The blaVIM gene was detected in all cultures except cultures KPQ and KPE strains, which showed an intermediate profile to imipenem, and were both sensitive to meropenem. In addition to VIM, no isolate harbored the blaIMP and blaNDM-1 encoding class B carbapenemases, or the genes encoding AmpC plasmid-mediated beta-lactamases. Discussion The emergence and spread of multi-resistant K. pneumoniae underlines that there is an urgent need to implement rapid and sensitive strategies for the identification and control of resistant isolates, and the application of molecular typing methods is required to define the structure and dynamics of the bacteriums population, Strain IMP MER AMP AMC PIP TZP CAZ PEP CTX AN GM CIP LVX ATM KP A 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP B 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 32 > 8 > 2 > 4 > 16 KP C 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP D > 8 > 8 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 16 > 8 > 2 > 4 > 16 KP E 8 2 > 16 ≥ 16 >64 >64 <= 1 > 16 > 32 <= 8 <= 2 <= 0,5 <= 1 > 16 KP F > 8 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP G 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP H 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 16 > 8 > 2 > 4 > 16 KP I 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP K 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 16 > 8 > 2 > 4 > 16 KP L 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP M 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP N <= 1 <= 1 > 16 ≥ 16 >64 32 > 16 > 16 > 32 <= 8 > 8 <= 0.5 <= 1 > 16 KP O 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP P 4 2 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP Q 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP R 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP S > 8 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP T <= 1 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP V 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP W <= 1 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP Y 4 <= 1 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 KP Z > 8 > 8 > 16 ≥ 16 >64 >64 > 16 > 16 > 32 <= 8 > 8 > 2 > 4 > 16 Table 3: Results of MICs (μg/ml) evaluation of 22 K. pneumoniae strains. Abbreviations: IMP: Imipenem; MER: Meropenem; AMP: Ampicillin; AMC: Amoxicillin-clavulanate; PIP: Piperacillin; TZP: Piperacillin-tazobactam; CAZ: Ceftazidime; PEP: Cefepime; CTX: Cefotaxime; AN: Amikacin; GM: Gentamicin; CIP: Ciprofloxacin; LVX: Levofloxacin; ATM: Aztreonam The MICs results (S=Sensitive; R=Resistant; I=Intermediate) were interpreted according to EUCAST as follows: S ≤2, R > 8, I when S < x >R for IMP and MER; S ≤8 and R > 8 for AMP and AMC; S ≤ 8, R > 16, I when S< x >R for PIP TZP and AN; S ≤ 1, R > 4, I when S< x >R for CAZ, PEP and ATM; S ≤ 1, R > 2, I when S< x >R for CTX and LVX; S ≤2, R>4 I when S < x >R for GM; S ≤ 0.5 and R>1 for CIP. Giancarlo Ripabelli, et al. Journal of Respiratory Medicine and Lung Disease Remedy Publications LLC. 2017 | Volume 2 | Issue 1 | Article 1008 5 especially in hospital settings [26]. The present study describes the results of characterization of 22 K. pneumoniae isolated from patients with respiratory tract infection in an intensive care unit. The antibiotic profile or resisto type was determined for each isolate by testing against a panel of fourteen antibiotics, including two carbapenems. The identified antibiotic resistance profiles were supported by PCR detection of resistance-associated genes, while PFGE typing allowed describing the intraspecific structure of the tested isolates. The PFGE analysis revealed a high genomic diversity among isolates characterized by similar or identical antibiotic-resistance types, suggesting a wide heterogeneity in strains circulation within the hospital ward during the study period. Although at the time of the study, KPC carbapenemase is considered as the most epidemiologically important and widespread determinant conferring resistance to carbapenems in Italy [27], none of the tested strains harbored the blaKPC gene. However, the lack of this gene was partially supported by the intermediate and sensitive antibiotic phenotypes for both imipenem and meropenem detected for the majority of the isolates tested. In Italy, compared to the continued dissemination and transmission of KPC class A carbapenemase, the other carbapenem resistance mechanisms are still considered minor or emerging concerns, being associated with sporadic reports [18] and linked to mobility and travel from areas where such resistance is endemic. In this study, the presence of GES carbapenemase was not detected in any isolate examined, and this observation is in agreement with the available recent epidemiological data, showing the circulation of these enzymes mostly in specific European countries (i.e., France, Greece, Portugal), as well as in South Africa and Southeast Asia [28]. Conversely, our analysis indicated that about 91% of isolates harbored bla VIM, suggesting the production of VIM carbapenemase as the only mechanism for the intermediate and resistant phenotypes. Only two isolates were bla VIM negative, and both were classified as intermediate to imipenem and sensitive to meropenem, respectively. The detection of VIM characterized by susceptible and/or intermediate profile to carbapenems was similarly reported in a recent study conducted in Spain [29], where 43 K. pneumoniae cultures harbored the bla VIM gene, although the 63.9% and 49.5% were sensitive to meropenem and imipenem, respectively. In a previous study [16], 234 K. pneumoniae isolates were characterized as resistant to ertapenem, and the other strains as intermediate or susceptible to imipenem and meropenem; the isolates with a susceptible or intermediate phenotype to imipenem and/or meropenem were VIM and OXA-48 producers and the other carbapenemases were not detected, while the strains harboring KPC were resistant to both imipenem and meropenem. Hence, these data suggest that VIM producing K. pneumoniae are still confined to sporadic cases or small outbreaks in Italy, and are not widely disseminated [27,30]. The blaIMP gene was not detected on K. pneumonaie isolates, and this finding is in agreement with previous reports indicating among class B carbapenemase a more frequent detection of VIM instead of IMP, which was not identified in any resistant strains [31]. Indeed, IMP and VIM production is still relatively rare amongst members of the Enterobacteriaceae [8] except for K. pneumoniae circulating in the European Mediterranean basin, with VIM carbapenemase mostly detected in Greece, Italy, and Spain, and E. coli IMP-producers in Taiwan and Japan [31]. The NDM-1 class B and OXA-48 class D carbapenemases were also not detected in the 22 K. pneumoniae tested here, and previous reports have also described that isolates resistant to carbapenems, particularly to ertapenem, do not contain these genes coding for beta-lactamase. In a recent study [32], K. pneumoniae strains were resistant to beta-lactam antibiotics, including carbapenems and penicillins/inhibitors, colistin and ciprofloxacin; however, among genes encoding carbapenemases and AmpC plasmid-mediated betalactamase, only the presence of blaKPC-3, blaTEM-1 and blaSHV-1 genes was identified. Moreover, the isolation of 15 K. pneumoniae cultures resistant to carbapenems and colistin in an Italian hospital was reported [33], and all isolates were negative for AmpC, metallobeta-lactamase and ESBL, but contained blaKPC and were positive by the modified Hodge test [34,35] and were therefore considered as KPC producers. The absence of NDM-1 in our strains is in agreement with the low detection rate of this determinant in Italy, where the first NDM-1 identification was described in E. coli isolated from a patient who had an epidemiological link with areas endemic for this carbapenemase. Moreover, during 2008-2010, a total of 77 cases infected by K. pneumoniae containing NDM-1 from 13 European countries were reported [36]. Similarly, the OXA-48 enzyme was reported in Italy among strains from cross-border origin but only in the last years with a limited distribution [27]. The genes coding for AmpC enzymes were also not detected. In Italy, previous studies only confirmed the presence of blaFOX gene [37], while other AmpC beta-lactamases were frequently reported in other countries [27]. At state of the art, carbapenemases are mainly found in K. pneumoniae and to a lesser extent in E. coli and other members of the Enterobacteriaceae, with higher prevalence in southern Europe and Asia. The high prevalence of carbapenemase producing enterobacteria in a hospital environment will globally contribute to persistent spread of K. pneumoniae producing all types of carbapenemases, mainly KPC, VIM, NDM-1 and OXA-48. Since these enzymes are able to hydrolyze almost all beta-lactam antibiotics and isolates are often Figure 1: PFGE-based dendrogram and resistotype for 22 K. pneumoniae isolated from respiratory tract infection. Giancarlo Ripabelli, et al. Journal of Respiratory Medicine and Lung Disease Remedy Publications LLC. 2017 | Volume 2 | Issue 1 | Article 1008 6 resistant to other classes of antibiotics, the selective pressure and the likelihood of persistence of such strains may increase. In addition, some “successful” clones and hypervirulent strains may increase the likelihood of dissemination and change the endemicity characteristics at global level [38]. In conclusion, this study reports, for the first time, the results of biomolecular analysis conducted on multidrug-resistant K. pneumoniae isolated from patients with respiratory tract infections and hospitalized in an intensive care unit in the Molise Region of Central Italy. The results provide hitherto unavailable information for the implementation of surveillance and control of infections and for limiting the dissemination of resistance genes, not only at a local level. The monitoring, surveillance and molecular typing are, therefore, essential to control the emergence of multidrugresistant strains in nosocomial settings, and to reduce the frequency of outbreaks. Exploring the antibiotic resistance phenotype, the resistance-mediated gene profiles and investigating the dynamics of K. pneumoniae population in a hospital setting can allow an understanding of the evolution and the complex interchange between genes, plasmids and clones. Moreover, the implementation of rigorous control measures, the appropriate management of antibiotic therapy or “antimicrobial stewardship”, and the promotion of awareness of the hazard represented by K. pneumoniae resistant strains are crucial to preserve the latest therapeutic options available for treating these infections.